Conserved sequence

Results: 98



#Item
1Biology / Genetics / Gene expression / DNA / Bioinformatics / Phylogenetic footprinting / SOS box / DNA binding site / Transcription factor / Noncoding DNA / Conserved sequence

Genome Informatics 13: 297–Prediction of Co-Regulated Genes in Eubacterial Genomes by Phylogenetic Footprinting

Add to Reading List

Source URL: www.jsbi.org

Language: English - Date: 2002-12-19 23:03:40
2Biology / Bioinformatics / Computational phylogenetics / Genetics / Population genetics / Molecular biology / Protein structure / Sequence alignment / Single-nucleotide polymorphism / BLAST / Protein superfamily / Conserved sequence

Table of Contents Use Cases (Target Problems)...........................................................................................................................1 Family alignment: identify homologues, generate fa

Add to Reading List

Source URL: informatics.nescent.org

Language: English - Date: 2016-04-13 13:52:16
3Biology / Molecular biology / ENCODE / Bioinformatics / Sequence analysis / Sequence alignment / DNA methylation / DNA / RNA-Seq / Nucleic acid sequence / Conserved sequence / Gene expression

548 1670T Posters Bioinformatics and Genomic Technology KeBABS: an R/Bioconductor package for kernel-based analysis of

Add to Reading List

Source URL: www.bioinf.jku.at

Language: English - Date: 2015-09-24 04:53:40
4Biology / Genetics / Bioinformatics / Computational phylogenetics / Nucleic acids / Genomics / Evolutionary biology / Sequence alignment / Multiple sequence alignment / Comparative genomics / Conserved sequence / Nucleic acid sequence

Genome Informatics 15(2): 21–Computational Methods for the Analysis of Differential Conservation in Groups of Similar DNA Sequences

Add to Reading List

Source URL: www.jsbi.org

Language: English - Date: 2004-12-16 23:36:49
5Biology / Genetics / Gene expression / DNA / Molecular biology / Noncoding DNA / Conserved sequence / Phylogenetic footprinting / Regulatory sequence / Gene / Human genome

Genome Informatics 13: 299–Development of an Efficient Method to Search Conserved Noncoding Sequences

Add to Reading List

Source URL: www.jsbi.org

Language: English - Date: 2002-12-19 23:03:34
6Bioinformatics / Computational phylogenetics / Nucleic acids / Suffix tree / Evolutionary biology / Molecular biology / MUMmer / Multiple sequence alignment / Sequence alignment / Conserved sequence / Nucleic acid sequence / Homology

WSEAS TRANSACTIONS on BIOLOGY and BIOMEDICINE S.M. Yiu P.Y. Chan T.W. Lam W.K. Sung H.F. Ting P.W.H. Wong Allowing Mismatches in Anchors for Whole Genome Alignment

Add to Reading List

Source URL: www.wseas.us

Language: English - Date: 2008-03-13 05:22:34
7Biology / Gene expression / Bioinformatics / Genomics / Operon / Biological databases / Phylogenetic footprinting / Ridge / DNA binding site / Gene / Conserved sequence / Fis

PFP: A Computational Framework for Phylogenetic Footprinting in Prokaryotic Genomes Dongsheng Che1,2 , Guojun Li1 , Shane T. Jensen3 , Jun S. Liu4 , and Ying Xu1 1 Computational Systems Biology Laboratory,

Add to Reading List

Source URL: www-stat.wharton.upenn.edu

Language: English - Date: 2008-08-30 09:43:43
8Biology / Bioinformatics / Genetics / Evolutionary biology / Computational phylogenetics / Molecular genetics / Amino acid / Mutation / Conserved sequence / Sequence alignment / Homology / Protein

Conservation of Physicochemical Properties during Protein Evolution Masashi Fujita Masumi Itoh

Add to Reading List

Source URL: www.jsbi.org

Language: English - Date: 2005-01-20 03:11:28
9Gene expression / Promoter / Sequence

Prediction of Promoter Expression Speci city by Conserved Sequence Patterns 1 1

Add to Reading List

Source URL: www.jsbi.org

Language: English - Date: 1998-01-09 02:50:14
10Biology / Genetics / Bioinformatics / Genomics / Genetic mapping / Human evolution / Human genetics / Human genome / Conserved sequence / Noncoding DNA / Genome / Comparative genomics

GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA

Add to Reading List

Source URL: bejerano.stanford.edu

Language: English - Date: 2009-04-17 16:28:41
UPDATE